Sequence retrieval

Genome: Flavobacteriales bacterium HTCC2170
Start position: 2245387
End position: 2245431
Length: 45

DNA sequence
>NC_014472, from 2245387 to 2245431 (45 bp); Flavobacteriales bacterium HTCC2170 CGAATCCGCCTCCGCCGAATCCGCCGCTGAAGCCTCCGCCTCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2245359-2246153	Sequence	FB2170_08814 - hypothetical protein (Protein is coded in complementary strand; from 2246153 to 2245359)