Sequence retrieval

Genome: Flavobacteriales bacterium HTCC2170
Start position: 2132961
End position: 2132984
Length: 24

DNA sequence
>NC_014472, from 2132961 to 2132984 (24 bp); Flavobacteriales bacterium HTCC2170 TTTCTTTTTCTGTGTCTTTTTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2132888-2133508	Sequence	FB2170_08299 - hypothetical protein (Protein is coded in complementary strand; from 2133508 to 2132888)