Sequence retrieval

Genome: Flavobacteriales bacterium HTCC2170
Start position: 1567577
End position: 1567609
Length: 33

DNA sequence
>NC_014472, from 1567577 to 1567609 (33 bp); Flavobacteriales bacterium HTCC2170 CTATTCCCAGGGTATTCCCAGTCTATTGCAAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1567526-1568065	Sequence	FB2170_05805 - dTDP-4-dehydrorhamnose 3,5-epimerase (Protein is coded in complementary strand; from 1568065 to 1567526)