Sequence retrieval

Genome: Flavobacteriales bacterium HTCC2170
Start position: 1534957
End position: 1534980
Length: 24

DNA sequence
>NC_014472, from 1534957 to 1534980 (24 bp); Flavobacteriales bacterium HTCC2170 TACCGATACCGATACCTACACCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1534830-1535021	Sequence	FB2170_05625 - hypothetical protein (Protein is coded in complementary strand; from 1535021 to 1534830)