Sequence retrieval

Genome: Flavobacteriales bacterium HTCC2170
Start position: 1374711
End position: 1374734
Length: 24

DNA sequence
>NC_014472, from 1374711 to 1374734 (24 bp); Flavobacteriales bacterium HTCC2170 TATCATTAACATTATCATTATCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1374638-1376401	Sequence	FB2170_04895 - Na+/Pi-cotransporter (Protein is coded in complementary strand; from 1376401 to 1374638)