Sequence retrieval

Genome: Flavobacteriales bacterium HTCC2170
Start position: 1126313
End position: 1126337
Length: 25

DNA sequence
>NC_014472, from 1126313 to 1126337 (25 bp); Flavobacteriales bacterium HTCC2170 TTCTTTTCATTTCCTTTCTGTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1124932-1126323	Sequence	FB2170_03870 - hypothetical protein (Protein is coded in complementary strand; from 1126323 to 1124932)