Sequence retrieval

Genome: Thermoanaerobacterium thermosaccharolyticum DSM 571
Start position: 2671239
End position: 2671301
Length: 63

DNA sequence
>NC_014410, from 2671239 to 2671301 (63 bp); Thermoanaerobacterium thermosaccharolyticum DSM 571 CCTCTTATCAACACTATCAAACCTCTTGTCTACATCATCAAACCTCTTATCAACGCTGTCAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2671030-2671572	Sequence	Tthe_2645 - hypothetical protein (Protein is coded in complementary strand; from 2671572 to 2671030)