Sequence retrieval

Genome: Thermoanaerobacterium thermosaccharolyticum DSM 571
Start position: 2270030
End position: 2270077
Length: 48

DNA sequence
>NC_014410, from 2270030 to 2270077 (48 bp); Thermoanaerobacterium thermosaccharolyticum DSM 571 GCCTTTTTCAATACCTTTTTCAATTCCTTTTTCAATACCTTTTTCAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2269923-2270777	Sequence	Tthe_2270 - transposase YhgA family protein (Protein is coded in complementary strand; from 2270777 to 2269923)