Sequence retrieval

Genome: Thermoanaerobacterium thermosaccharolyticum DSM 571
Start position: 1617285
End position: 1617320
Length: 36

DNA sequence
>NC_014410, from 1617285 to 1617320 (36 bp); Thermoanaerobacterium thermosaccharolyticum DSM 571 AGTTTTAGATTCAGATTTAGATACTGTTTTAGATGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1616945-1617436	Sequence	Tthe_1621 - hypothetical protein