Sequence retrieval

Genome: Thermoanaerobacterium thermosaccharolyticum DSM 571
Start position: 1043462
End position: 1043497
Length: 36

DNA sequence
>NC_014410, from 1043462 to 1043497 (36 bp); Thermoanaerobacterium thermosaccharolyticum DSM 571 CCTTTTTCAATACCCTTTTCAATACCTTTCTCAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1043345-1044199	Sequence	Tthe_1015 - transposase YhgA family protein (Protein is coded in complementary strand; from 1044199 to 1043345)