Sequence retrieval

Genome: Thermoanaerobacterium thermosaccharolyticum DSM 571
Start position: 429494
End position: 429523
Length: 30

DNA sequence
>NC_014410, from 429494 to 429523 (30 bp); Thermoanaerobacterium thermosaccharolyticum DSM 571 AAAATTATAACAAATAATAAGAAATTATGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 429196-429504	Sequence	Tthe_0431 - 30S ribosomal protein S10