Sequence retrieval

Genome: Thermoanaerobacterium thermosaccharolyticum DSM 571
Start position: 1530660
End position: 1530689
Length: 30

DNA sequence
>NC_014410, from 1530660 to 1530689 (30 bp); Thermoanaerobacterium thermosaccharolyticum DSM 571 AAAAAAGAAAAATAAAGACAAAAAACAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1529336-1531054	Sequence	Tthe_1535 - Fibronectin-binding A domain-containing protein