Sequence retrieval

Genome: Thermoanaerobacterium thermosaccharolyticum DSM 571
Start position: 1283141
End position: 1283170
Length: 30

DNA sequence
>NC_014410, from 1283141 to 1283170 (30 bp); Thermoanaerobacterium thermosaccharolyticum DSM 571 AAGATTTTCAAAGATATTAAAAGATTTAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1282567-1283598	Sequence	Tthe_1261 - hypothetical protein