Sequence retrieval

Genome: Thermoanaerobacterium thermosaccharolyticum DSM 571
Start position: 206827
End position: 206853
Length: 27

DNA sequence
>NC_014410, from 206827 to 206853 (27 bp); Thermoanaerobacterium thermosaccharolyticum DSM 571 TAAAAATAATAAAAACAATAAAAATAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 206781-208427	Sequence	Tthe_0211 - GerA spore germination protein