Sequence retrieval

Genome: Thermoanaerobacterium thermosaccharolyticum DSM 571
Start position: 2774879
End position: 2774903
Length: 25

DNA sequence
>NC_014410, from 2774879 to 2774903 (25 bp); Thermoanaerobacterium thermosaccharolyticum DSM 571 TTTAATGTAATCTAAGTTAATGTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2774868-2776166	Sequence	Tthe_2745 - radical SAM protein (Protein is coded in complementary strand; from 2776166 to 2774868)