Sequence retrieval

Genome: Thermoanaerobacterium thermosaccharolyticum DSM 571
Start position: 2334351
End position: 2334375
Length: 25

DNA sequence
>NC_014410, from 2334351 to 2334375 (25 bp); Thermoanaerobacterium thermosaccharolyticum DSM 571 TTTTTTGTTTTTATTTTATTTCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2334367-2335224	Sequence	Tthe_2341 - cation diffusion facilitator family transporter (Protein is coded in complementary strand; from 2335224 to 2334367)