Sequence retrieval

Genome: Thermoanaerobacterium thermosaccharolyticum DSM 571
Start position: 989735
End position: 989758
Length: 24

DNA sequence
>NC_014410, from 989735 to 989758 (24 bp); Thermoanaerobacterium thermosaccharolyticum DSM 571 AGTATACAAGAATACAAGTATGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 989698-990465	Sequence	Tthe_0974 - GntR family transcriptional regulator