Sequence retrieval

Genome: Thermoanaerobacterium thermosaccharolyticum DSM 571
Start position: 2641209
End position: 2641232
Length: 24

DNA sequence
>NC_014410, from 2641209 to 2641232 (24 bp); Thermoanaerobacterium thermosaccharolyticum DSM 571 TGTATTTGTATTAGTATTTGTACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2640421-2641860	Sequence	Tthe_2617 - S-layer domain-containing protein (Protein is coded in complementary strand; from 2641860 to 2640421)