Sequence retrieval

Genome: Thermoanaerobacterium thermosaccharolyticum DSM 571
Start position: 2571018
End position: 2571041
Length: 24

DNA sequence
>NC_014410, from 2571018 to 2571041 (24 bp); Thermoanaerobacterium thermosaccharolyticum DSM 571 TTATCTTTATATTTATCCTTATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2570360-2571295	Sequence	Tthe_2552 - 1-phosphofructokinase (Protein is coded in complementary strand; from 2571295 to 2570360)