Sequence retrieval

Genome: Thermoanaerobacterium thermosaccharolyticum DSM 571
Start position: 1611140
End position: 1611163
Length: 24

DNA sequence
>NC_014410, from 1611140 to 1611163 (24 bp); Thermoanaerobacterium thermosaccharolyticum DSM 571 TATTATTATTGTTACTATTGTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1610274-1611644	Sequence	Tthe_1613 - integral membrane sensor signal transduction histidine kinase (Protein is coded in complementary strand; from 1611644 to 1610274)