Sequence retrieval

Genome: Thermoanaerobacterium thermosaccharolyticum DSM 571
Start position: 1515065
End position: 1515088
Length: 24

DNA sequence
>NC_014410, from 1515065 to 1515088 (24 bp); Thermoanaerobacterium thermosaccharolyticum DSM 571 TTGCTGTTGTTGTTGCTGTTGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1514829-1516736	Sequence	Tthe_1520 - serine/threonine protein kinase with PASTA sensor(s) (Protein is coded in complementary strand; from 1516736 to 1514829)