Sequence retrieval

Genome: Thermoanaerobacterium thermosaccharolyticum DSM 571
Start position: 1086218
End position: 1086241
Length: 24

DNA sequence
>NC_014410, from 1086218 to 1086241 (24 bp); Thermoanaerobacterium thermosaccharolyticum DSM 571 ATTTTTAATTTTATCTTTATTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1085721-1086434	Sequence	Tthe_1058 - 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase (Protein is coded in complementary strand; from 1086434 to 1085721)