Sequence retrieval

Genome: Bacillus anthracis CI
Start position: 752522
End position: 752545
Length: 24

DNA sequence
>NC_014335, from 752522 to 752545 (24 bp); Bacillus anthracis CI GAAAATTAAAATGATAATGAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 751485-752567	Sequence	BACI_c07950 gerAC1 spore germination protein (Protein is coded in complementary strand; from 752567 to 751485)