Sequence retrieval

Genome: Bacillus anthracis CI
Start position: 716411
End position: 716434
Length: 24

DNA sequence
>NC_014335, from 716411 to 716434 (24 bp); Bacillus anthracis CI TGTTTGAGTTTGTGATTGCGTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 715995-717155	Sequence	BACI_c07530 - NLP/P60 family peptidase (Protein is coded in complementary strand; from 717155 to 715995)