Sequence retrieval

Genome: Bacillus anthracis CI
Start position: 588148
End position: 588177
Length: 30

DNA sequence
>NC_014335, from 588148 to 588177 (30 bp); Bacillus anthracis CI AATACTTGCAAATACTTGCAAATACTTGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 588127-589482	Sequence	BACI_c06220 - Di-/tripeptide transporter protein (Protein is coded in complementary strand; from 589482 to 588127)