Sequence retrieval

Genome: Bacillus anthracis CI
Start position: 585713
End position: 585736
Length: 24

DNA sequence
>NC_014335, from 585713 to 585736 (24 bp); Bacillus anthracis CI TTCTTTTTCTTTTTGTTTTTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 584946-586565	Sequence	BACI_c06190 lctP L-lactate permease (Protein is coded in complementary strand; from 586565 to 584946)