Sequence retrieval

Genome: Bacillus anthracis CI
Start position: 5100038
End position: 5100062
Length: 25

DNA sequence
>NC_014335, from 5100038 to 5100062 (25 bp); Bacillus anthracis CI TTTCTTCTCTTTTATATTCTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5099931-5101502	Sequence	BACI_c54070 - two-component sensor protein (Protein is coded in complementary strand; from 5101502 to 5099931)