Sequence retrieval

Genome: Bacillus anthracis CI
Start position: 4984444
End position: 4984467
Length: 24

DNA sequence
>NC_014335, from 4984444 to 4984467 (24 bp); Bacillus anthracis CI GCCTTCGCTTTCGCTTTCGCCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4983778-4985043	Sequence	BACI_c52920 nuoC NADH dehydrogenase I subunit C (Protein is coded in complementary strand; from 4985043 to 4983778)