Sequence retrieval

Genome: Bacillus anthracis CI
Start position: 4640651
End position: 4640680
Length: 30

DNA sequence
>NC_014335, from 4640651 to 4640680 (30 bp); Bacillus anthracis CI ACTTTTACTTCTTCTTTTACTTTTACTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4637099-4645273	Sequence	BACI_c49350 - cell surface protein (Protein is coded in complementary strand; from 4645273 to 4637099)