Sequence retrieval

Genome: Bacillus anthracis CI
Start position: 4600518
End position: 4600541
Length: 24

DNA sequence
>NC_014335, from 4600518 to 4600541 (24 bp); Bacillus anthracis CI TGCTTCTCCTTCTGCTTTTGCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4599715-4600659	Sequence	BACI_c48760 ldh2 L-lactate dehydrogenase (Protein is coded in complementary strand; from 4600659 to 4599715)