Sequence retrieval

Genome: Bacillus anthracis CI
Start position: 4492696
End position: 4492719
Length: 24

DNA sequence
>NC_014335, from 4492696 to 4492719 (24 bp); Bacillus anthracis CI AGCTTTTTATCTTTTTATCTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4492719-4493102	Sequence	BACI_c47690 atpI2 ATP synthase subunit I (Protein is coded in complementary strand; from 4493102 to 4492719)