Sequence retrieval

Genome: Bacillus anthracis CI
Start position: 4453676
End position: 4453702
Length: 27

DNA sequence
>NC_014335, from 4453676 to 4453702 (27 bp); Bacillus anthracis CI GTGTTTCCCGTGTTTCCCGTGTTTCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4453160-4455721	Sequence	BACI_c47240 - collagen triple helix repeat domain-containing protein (Protein is coded in complementary strand; from 4455721 to 4453160)