Sequence retrieval

Genome: Bacillus anthracis CI
Start position: 4362384
End position: 4362407
Length: 24

DNA sequence
>NC_014335, from 4362384 to 4362407 (24 bp); Bacillus anthracis CI TATTCTCTTATGCTCTTGTTCTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4362118-4362813	Sequence	BACI_c46230 - hypothetical protein (Protein is coded in complementary strand; from 4362813 to 4362118)