Sequence retrieval

Genome: Bacillus anthracis CI
Start position: 4266378
End position: 4266431
Length: 54

DNA sequence
>NC_014335, from 4266378 to 4266431 (54 bp); Bacillus anthracis CI CCCGTTGCTCCTGTTGATCCCGTTATTCCTGTTGCTCCCGTTACTCCTGTTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4265856-4266560	Sequence	BACI_c45190 - collagen triple helix repeat domain-containing protein (Protein is coded in complementary strand; from 4266560 to 4265856)