Sequence retrieval

Genome: Bacillus anthracis CI
Start position: 3778236
End position: 3778259
Length: 24

DNA sequence
>NC_014335, from 3778236 to 3778259 (24 bp); Bacillus anthracis CI AACTTTTACTTTTACTTTTACTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3777184-3778449	Sequence	BACI_c39720 - maltose-maltodextrin ABC-related solute binding protein (Protein is coded in complementary strand; from 3778449 to 3777184)