Sequence retrieval

Genome: Bacillus anthracis CI
Start position: 3659282
End position: 3659305
Length: 24

DNA sequence
>NC_014335, from 3659282 to 3659305 (24 bp); Bacillus anthracis CI CAATCTTCAAATCTTCAAATCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3658819-3659733	Sequence	BACI_c38420 pyrB aspartate carbamoyltransferase (Protein is coded in complementary strand; from 3659733 to 3658819)