Sequence retrieval

Genome: Bacillus anthracis CI
Start position: 3544877
End position: 3544921
Length: 45

DNA sequence
>NC_014335, from 3544877 to 3544921 (45 bp); Bacillus anthracis CI TTGTTCCTCTTTCTTCGGTTCTTCTTTCTTTGGTTCCTCTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3544521-3545432	Sequence	BACI_c37330 - hypothetical protein (Protein is coded in complementary strand; from 3545432 to 3544521)