Sequence retrieval

Genome: Bacillus anthracis CI
Start position: 3468068
End position: 3468094
Length: 27

DNA sequence
>NC_014335, from 3468068 to 3468094 (27 bp); Bacillus anthracis CI CCTACTGGACCTACTGGGCCTTCTGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3466788-3468494	Sequence	BACI_c36610 - collagen triple helix repeat domain-containing protein