Sequence retrieval

Genome: Bacillus anthracis CI
Start position: 3407471
End position: 3407494
Length: 24

DNA sequence
>NC_014335, from 3407471 to 3407494 (24 bp); Bacillus anthracis CI TATCAACATCAATAGCAATAACAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3406399-3408057	Sequence	BACI_c36000 hutU urocanate hydratase (Protein is coded in complementary strand; from 3408057 to 3406399)