Sequence retrieval

Genome: Bacillus anthracis CI
Start position: 3047075
End position: 3047098
Length: 24

DNA sequence
>NC_014335, from 3047075 to 3047098 (24 bp); Bacillus anthracis CI TCCTCTTCCCCTTCCTCATCTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3046823-3047563	Sequence	BACI_c32290 - DnaD domain-containing protein (Protein is coded in complementary strand; from 3047563 to 3046823)