Sequence retrieval

Genome: Bacillus anthracis CI
Start position: 2915341
End position: 2915364
Length: 24

DNA sequence
>NC_014335, from 2915341 to 2915364 (24 bp); Bacillus anthracis CI TTTTTTAATTTTTTACTTTTTTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2913979-2915388	Sequence	BACI_c31010 - MATE efflux family protein (Protein is coded in complementary strand; from 2915388 to 2913979)