Sequence retrieval

Genome: Bacillus anthracis CI
Start position: 2585286
End position: 2585321
Length: 36

DNA sequence
>NC_014335, from 2585286 to 2585321 (36 bp); Bacillus anthracis CI CAATCCCAATTACGATCCCAATCACAATTCCGATTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2585270-2585419	Sequence	BACI_c27480 - hypothetical protein (Protein is coded in complementary strand; from 2585419 to 2585270)