Sequence retrieval

Genome: Bacillus anthracis CI
Start position: 2252249
End position: 2252275
Length: 27

DNA sequence
>NC_014335, from 2252249 to 2252275 (27 bp); Bacillus anthracis CI CAACAGGAGCAACAGGAGCAACAGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2252156-2252599	Sequence	BACI_c23910 - collagen triple helix repeat domain-containing protein