Sequence retrieval

Genome: Bacillus anthracis CI
Start position: 2225459
End position: 2225486
Length: 28

DNA sequence
>NC_014335, from 2225459 to 2225486 (28 bp); Bacillus anthracis CI TTGTTAGTTGTTAGTTGTTAGTTGTTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2225477-2226361	Sequence	BACI_c23620 - drug/metabolite exporter family permease (Protein is coded in complementary strand; from 2226361 to 2225477)