Sequence retrieval

Genome: Bacillus anthracis CI
Start position: 1249052
End position: 1249096
Length: 45

DNA sequence
>NC_014335, from 1249052 to 1249096 (45 bp); Bacillus anthracis CI TTCTTCAGCAGGTTTTTGCTCAGCTGGTTTTTGTTCAGCAGGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1248666-1249478	Sequence	BACI_c13280 - SCP-like extracellular protein transporter (Protein is coded in complementary strand; from 1249478 to 1248666)