Sequence retrieval

Genome: Bacillus anthracis CI
Start position: 1177490
End position: 1177516
Length: 27

DNA sequence
>NC_014335, from 1177490 to 1177516 (27 bp); Bacillus anthracis CI GGCCCAGTCGGCCCAGTCGGTCCAGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1177079-1177678	Sequence	BACI_c12480 bclA BclA protein (Protein is coded in complementary strand; from 1177678 to 1177079)