Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 892750
End position: 892776
Length: 27

DNA sequence
>NC_014323, from 892750 to 892776 (27 bp); Herbaspirillum seropedicae SmR1 ACACCCTGAATACCCTGAACATCCTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 891356-892759	Sequence	Hsero_0814 pilV type IV prepilin PilV protein
ORF. 892740-893237	Sequence	Hsero_0815 - soluble lytic murein transglycosylase