Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 86377
End position: 86400
Length: 24

DNA sequence
>NC_014323, from 86377 to 86400 (24 bp); Herbaspirillum seropedicae SmR1 CTGCGCCAGCGCCTGCGGCAGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 85184-86458	Sequence	Hsero_0072 rrmB RNA methyltransferase (Protein is coded in complementary strand; from 86458 to 85184)