Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 85046
End position: 85081
Length: 36

DNA sequence
>NC_014323, from 85046 to 85081 (36 bp); Herbaspirillum seropedicae SmR1 CAGCGCCAGCAGCAGCGCCAGCAGCAGCGCCAGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 84537-85187	Sequence	Hsero_0071 - proline rich signal peptide protein (Protein is coded in complementary strand; from 85187 to 84537)