Sequence retrieval

Genome: Herbaspirillum seropedicae SmR1
Start position: 662137
End position: 662160
Length: 24

DNA sequence
>NC_014323, from 662137 to 662160 (24 bp); Herbaspirillum seropedicae SmR1 CAGTTGCAGTTCCGGTTGCGGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 662003-662449	Sequence	Hsero_0604 exbD biopolymer transport ExbD/TolR protein (Protein is coded in complementary strand; from 662449 to 662003)